ID: 1171782041

View in Genome Browser
Species Human (GRCh38)
Location 20:29427966-29427988
Sequence CATGCCCCCCGCCAGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171782041_1171782053 12 Left 1171782041 20:29427966-29427988 CCCTGCCCCTGGCGGGGGGCATG No data
Right 1171782053 20:29428001-29428023 TGGGCAGAGGCGAAGGAAGCGGG No data
1171782041_1171782051 5 Left 1171782041 20:29427966-29427988 CCCTGCCCCTGGCGGGGGGCATG No data
Right 1171782051 20:29427994-29428016 AGAACGCTGGGCAGAGGCGAAGG No data
1171782041_1171782046 -8 Left 1171782041 20:29427966-29427988 CCCTGCCCCTGGCGGGGGGCATG No data
Right 1171782046 20:29427981-29428003 GGGGCATGCCCTCAGAACGCTGG No data
1171782041_1171782052 11 Left 1171782041 20:29427966-29427988 CCCTGCCCCTGGCGGGGGGCATG No data
Right 1171782052 20:29428000-29428022 CTGGGCAGAGGCGAAGGAAGCGG No data
1171782041_1171782048 -1 Left 1171782041 20:29427966-29427988 CCCTGCCCCTGGCGGGGGGCATG No data
Right 1171782048 20:29427988-29428010 GCCCTCAGAACGCTGGGCAGAGG No data
1171782041_1171782047 -7 Left 1171782041 20:29427966-29427988 CCCTGCCCCTGGCGGGGGGCATG No data
Right 1171782047 20:29427982-29428004 GGGCATGCCCTCAGAACGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171782041 Original CRISPR CATGCCCCCCGCCAGGGGCA GGG (reversed) Intergenic
No off target data available for this crispr