ID: 1171782070

View in Genome Browser
Species Human (GRCh38)
Location 20:29428083-29428105
Sequence CCCTGCCCGCGCTGTTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171782063_1171782070 -10 Left 1171782063 20:29428070-29428092 CCACTCCCTCCCACCCTGCCCGC No data
Right 1171782070 20:29428083-29428105 CCCTGCCCGCGCTGTTCCCTGGG No data
1171782062_1171782070 -5 Left 1171782062 20:29428065-29428087 CCTCTCCACTCCCTCCCACCCTG No data
Right 1171782070 20:29428083-29428105 CCCTGCCCGCGCTGTTCCCTGGG No data
1171782061_1171782070 13 Left 1171782061 20:29428047-29428069 CCTTGGGATGTGCTGGGTCCTCT No data
Right 1171782070 20:29428083-29428105 CCCTGCCCGCGCTGTTCCCTGGG No data
1171782056_1171782070 29 Left 1171782056 20:29428031-29428053 CCTTTCTCCACACTGACCTTGGG No data
Right 1171782070 20:29428083-29428105 CCCTGCCCGCGCTGTTCCCTGGG No data
1171782058_1171782070 22 Left 1171782058 20:29428038-29428060 CCACACTGACCTTGGGATGTGCT No data
Right 1171782070 20:29428083-29428105 CCCTGCCCGCGCTGTTCCCTGGG No data
1171782054_1171782070 30 Left 1171782054 20:29428030-29428052 CCCTTTCTCCACACTGACCTTGG No data
Right 1171782070 20:29428083-29428105 CCCTGCCCGCGCTGTTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171782070 Original CRISPR CCCTGCCCGCGCTGTTCCCT GGG Intergenic
No off target data available for this crispr