ID: 1171784803

View in Genome Browser
Species Human (GRCh38)
Location 20:29453049-29453071
Sequence CAGGGAATACAGATTGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171784803_1171784806 15 Left 1171784803 20:29453049-29453071 CCATGCACAATCTGTATTCCCTG No data
Right 1171784806 20:29453087-29453109 AAATCTAATTCTCACTATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171784803 Original CRISPR CAGGGAATACAGATTGTGCA TGG (reversed) Intergenic
No off target data available for this crispr