ID: 1171785953

View in Genome Browser
Species Human (GRCh38)
Location 20:29464694-29464716
Sequence AAGTCCTTCTAGAAGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171785953_1171785955 2 Left 1171785953 20:29464694-29464716 CCTTCACTCTTCTAGAAGGACTT No data
Right 1171785955 20:29464719-29464741 TTTGATAGGTCCTTTTTCCATGG No data
1171785953_1171785957 18 Left 1171785953 20:29464694-29464716 CCTTCACTCTTCTAGAAGGACTT No data
Right 1171785957 20:29464735-29464757 TCCATGGTTTAGAATAAAAGAGG 0: 17
1: 21
2: 24
3: 47
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171785953 Original CRISPR AAGTCCTTCTAGAAGAGTGA AGG (reversed) Intergenic
No off target data available for this crispr