ID: 1171787263

View in Genome Browser
Species Human (GRCh38)
Location 20:29479204-29479226
Sequence ACATGGCATCTGTACAAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171787263_1171787269 27 Left 1171787263 20:29479204-29479226 CCTAGCTTGTACAGATGCCATGT No data
Right 1171787269 20:29479254-29479276 TTAAAGGCTAGAACTAGATAGGG No data
1171787263_1171787266 1 Left 1171787263 20:29479204-29479226 CCTAGCTTGTACAGATGCCATGT No data
Right 1171787266 20:29479228-29479250 ACTCTAGATTTGGTGACAGAAGG No data
1171787263_1171787267 11 Left 1171787263 20:29479204-29479226 CCTAGCTTGTACAGATGCCATGT No data
Right 1171787267 20:29479238-29479260 TGGTGACAGAAGGAATTTAAAGG No data
1171787263_1171787264 -9 Left 1171787263 20:29479204-29479226 CCTAGCTTGTACAGATGCCATGT No data
Right 1171787264 20:29479218-29479240 ATGCCATGTAACTCTAGATTTGG No data
1171787263_1171787268 26 Left 1171787263 20:29479204-29479226 CCTAGCTTGTACAGATGCCATGT No data
Right 1171787268 20:29479253-29479275 TTTAAAGGCTAGAACTAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171787263 Original CRISPR ACATGGCATCTGTACAAGCT AGG (reversed) Intergenic
No off target data available for this crispr