ID: 1171788921

View in Genome Browser
Species Human (GRCh38)
Location 20:29500463-29500485
Sequence GTAGCTATTCTGACTGGTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171788921_1171788923 8 Left 1171788921 20:29500463-29500485 CCTATACCAGTCAGAATAGCTAC No data
Right 1171788923 20:29500494-29500516 AATCGAAAAACAACAGATCTTGG No data
1171788921_1171788926 18 Left 1171788921 20:29500463-29500485 CCTATACCAGTCAGAATAGCTAC No data
Right 1171788926 20:29500504-29500526 CAACAGATCTTGGGAGGCTGTGG No data
1171788921_1171788927 26 Left 1171788921 20:29500463-29500485 CCTATACCAGTCAGAATAGCTAC No data
Right 1171788927 20:29500512-29500534 CTTGGGAGGCTGTGGAGAAAAGG No data
1171788921_1171788925 12 Left 1171788921 20:29500463-29500485 CCTATACCAGTCAGAATAGCTAC No data
Right 1171788925 20:29500498-29500520 GAAAAACAACAGATCTTGGGAGG No data
1171788921_1171788928 27 Left 1171788921 20:29500463-29500485 CCTATACCAGTCAGAATAGCTAC No data
Right 1171788928 20:29500513-29500535 TTGGGAGGCTGTGGAGAAAAGGG No data
1171788921_1171788924 9 Left 1171788921 20:29500463-29500485 CCTATACCAGTCAGAATAGCTAC No data
Right 1171788924 20:29500495-29500517 ATCGAAAAACAACAGATCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171788921 Original CRISPR GTAGCTATTCTGACTGGTAT AGG (reversed) Intergenic
No off target data available for this crispr