ID: 1171794229

View in Genome Browser
Species Human (GRCh38)
Location 20:29554040-29554062
Sequence GCCCTGTGGTGACTGGCGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171794229_1171794237 16 Left 1171794229 20:29554040-29554062 CCTCTCGCCAGTCACCACAGGGC No data
Right 1171794237 20:29554079-29554101 CTACCTTCAAGAAGCTCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171794229 Original CRISPR GCCCTGTGGTGACTGGCGAG AGG (reversed) Intergenic
No off target data available for this crispr