ID: 1171794230 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:29554047-29554069 |
| Sequence | TCTCAGGGCCCTGTGGTGAC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1171794230_1171794237 | 9 | Left | 1171794230 | 20:29554047-29554069 | CCAGTCACCACAGGGCCCTGAGA | No data | ||
| Right | 1171794237 | 20:29554079-29554101 | CTACCTTCAAGAAGCTCAGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1171794230 | Original CRISPR | TCTCAGGGCCCTGTGGTGAC TGG (reversed) | Intergenic | ||