ID: 1171794231

View in Genome Browser
Species Human (GRCh38)
Location 20:29554054-29554076
Sequence ATGGGAGTCTCAGGGCCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171794231_1171794240 25 Left 1171794231 20:29554054-29554076 CCACAGGGCCCTGAGACTCCCAT No data
Right 1171794240 20:29554102-29554124 CTACTACTCATGTTCATGTTGGG No data
1171794231_1171794239 24 Left 1171794231 20:29554054-29554076 CCACAGGGCCCTGAGACTCCCAT No data
Right 1171794239 20:29554101-29554123 GCTACTACTCATGTTCATGTTGG No data
1171794231_1171794237 2 Left 1171794231 20:29554054-29554076 CCACAGGGCCCTGAGACTCCCAT No data
Right 1171794237 20:29554079-29554101 CTACCTTCAAGAAGCTCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171794231 Original CRISPR ATGGGAGTCTCAGGGCCCTG TGG (reversed) Intergenic
No off target data available for this crispr