ID: 1171794232

View in Genome Browser
Species Human (GRCh38)
Location 20:29554062-29554084
Sequence AGGTAGGAATGGGAGTCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171794232_1171794240 17 Left 1171794232 20:29554062-29554084 CCCTGAGACTCCCATTCCTACCT No data
Right 1171794240 20:29554102-29554124 CTACTACTCATGTTCATGTTGGG No data
1171794232_1171794241 30 Left 1171794232 20:29554062-29554084 CCCTGAGACTCCCATTCCTACCT No data
Right 1171794241 20:29554115-29554137 TCATGTTGGGTCACTACATACGG No data
1171794232_1171794237 -6 Left 1171794232 20:29554062-29554084 CCCTGAGACTCCCATTCCTACCT No data
Right 1171794237 20:29554079-29554101 CTACCTTCAAGAAGCTCAGCAGG No data
1171794232_1171794239 16 Left 1171794232 20:29554062-29554084 CCCTGAGACTCCCATTCCTACCT No data
Right 1171794239 20:29554101-29554123 GCTACTACTCATGTTCATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171794232 Original CRISPR AGGTAGGAATGGGAGTCTCA GGG (reversed) Intergenic
No off target data available for this crispr