ID: 1171794237

View in Genome Browser
Species Human (GRCh38)
Location 20:29554079-29554101
Sequence CTACCTTCAAGAAGCTCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171794230_1171794237 9 Left 1171794230 20:29554047-29554069 CCAGTCACCACAGGGCCCTGAGA No data
Right 1171794237 20:29554079-29554101 CTACCTTCAAGAAGCTCAGCAGG No data
1171794232_1171794237 -6 Left 1171794232 20:29554062-29554084 CCCTGAGACTCCCATTCCTACCT No data
Right 1171794237 20:29554079-29554101 CTACCTTCAAGAAGCTCAGCAGG No data
1171794233_1171794237 -7 Left 1171794233 20:29554063-29554085 CCTGAGACTCCCATTCCTACCTT No data
Right 1171794237 20:29554079-29554101 CTACCTTCAAGAAGCTCAGCAGG No data
1171794229_1171794237 16 Left 1171794229 20:29554040-29554062 CCTCTCGCCAGTCACCACAGGGC No data
Right 1171794237 20:29554079-29554101 CTACCTTCAAGAAGCTCAGCAGG No data
1171794231_1171794237 2 Left 1171794231 20:29554054-29554076 CCACAGGGCCCTGAGACTCCCAT No data
Right 1171794237 20:29554079-29554101 CTACCTTCAAGAAGCTCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171794237 Original CRISPR CTACCTTCAAGAAGCTCAGC AGG Intergenic
No off target data available for this crispr