ID: 1171794240

View in Genome Browser
Species Human (GRCh38)
Location 20:29554102-29554124
Sequence CTACTACTCATGTTCATGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171794232_1171794240 17 Left 1171794232 20:29554062-29554084 CCCTGAGACTCCCATTCCTACCT No data
Right 1171794240 20:29554102-29554124 CTACTACTCATGTTCATGTTGGG No data
1171794233_1171794240 16 Left 1171794233 20:29554063-29554085 CCTGAGACTCCCATTCCTACCTT No data
Right 1171794240 20:29554102-29554124 CTACTACTCATGTTCATGTTGGG No data
1171794234_1171794240 7 Left 1171794234 20:29554072-29554094 CCCATTCCTACCTTCAAGAAGCT No data
Right 1171794240 20:29554102-29554124 CTACTACTCATGTTCATGTTGGG No data
1171794238_1171794240 -3 Left 1171794238 20:29554082-29554104 CCTTCAAGAAGCTCAGCAGGCTA No data
Right 1171794240 20:29554102-29554124 CTACTACTCATGTTCATGTTGGG No data
1171794231_1171794240 25 Left 1171794231 20:29554054-29554076 CCACAGGGCCCTGAGACTCCCAT No data
Right 1171794240 20:29554102-29554124 CTACTACTCATGTTCATGTTGGG No data
1171794235_1171794240 6 Left 1171794235 20:29554073-29554095 CCATTCCTACCTTCAAGAAGCTC No data
Right 1171794240 20:29554102-29554124 CTACTACTCATGTTCATGTTGGG No data
1171794236_1171794240 1 Left 1171794236 20:29554078-29554100 CCTACCTTCAAGAAGCTCAGCAG No data
Right 1171794240 20:29554102-29554124 CTACTACTCATGTTCATGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171794240 Original CRISPR CTACTACTCATGTTCATGTT GGG Intergenic
No off target data available for this crispr