ID: 1171794844

View in Genome Browser
Species Human (GRCh38)
Location 20:29558748-29558770
Sequence GGCTGTGTCTGAAGGGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171794844_1171794855 28 Left 1171794844 20:29558748-29558770 CCTGCTGCCCTTCAGACACAGCC No data
Right 1171794855 20:29558799-29558821 ATCCCACCTTCCTTGTGAGCTGG No data
1171794844_1171794850 5 Left 1171794844 20:29558748-29558770 CCTGCTGCCCTTCAGACACAGCC No data
Right 1171794850 20:29558776-29558798 CCCTCAAGCTGCCCTCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171794844 Original CRISPR GGCTGTGTCTGAAGGGCAGC AGG (reversed) Intergenic
No off target data available for this crispr