ID: 1171797209

View in Genome Browser
Species Human (GRCh38)
Location 20:29576044-29576066
Sequence ATTTTGGCGTACATTAAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171797209_1171797221 21 Left 1171797209 20:29576044-29576066 CCCACCTTAATGTACGCCAAAAT No data
Right 1171797221 20:29576088-29576110 GGAGTTCCCTGCAACGGGTGGGG No data
1171797209_1171797222 25 Left 1171797209 20:29576044-29576066 CCCACCTTAATGTACGCCAAAAT No data
Right 1171797222 20:29576092-29576114 TTCCCTGCAACGGGTGGGGAAGG No data
1171797209_1171797220 20 Left 1171797209 20:29576044-29576066 CCCACCTTAATGTACGCCAAAAT No data
Right 1171797220 20:29576087-29576109 TGGAGTTCCCTGCAACGGGTGGG No data
1171797209_1171797219 19 Left 1171797209 20:29576044-29576066 CCCACCTTAATGTACGCCAAAAT No data
Right 1171797219 20:29576086-29576108 CTGGAGTTCCCTGCAACGGGTGG No data
1171797209_1171797217 16 Left 1171797209 20:29576044-29576066 CCCACCTTAATGTACGCCAAAAT No data
Right 1171797217 20:29576083-29576105 GGCCTGGAGTTCCCTGCAACGGG No data
1171797209_1171797214 -5 Left 1171797209 20:29576044-29576066 CCCACCTTAATGTACGCCAAAAT No data
Right 1171797214 20:29576062-29576084 AAAATAGTTCTGCTGGTTGAAGG No data
1171797209_1171797225 27 Left 1171797209 20:29576044-29576066 CCCACCTTAATGTACGCCAAAAT No data
Right 1171797225 20:29576094-29576116 CCCTGCAACGGGTGGGGAAGGGG No data
1171797209_1171797216 15 Left 1171797209 20:29576044-29576066 CCCACCTTAATGTACGCCAAAAT No data
Right 1171797216 20:29576082-29576104 AGGCCTGGAGTTCCCTGCAACGG No data
1171797209_1171797215 0 Left 1171797209 20:29576044-29576066 CCCACCTTAATGTACGCCAAAAT No data
Right 1171797215 20:29576067-29576089 AGTTCTGCTGGTTGAAGGCCTGG No data
1171797209_1171797223 26 Left 1171797209 20:29576044-29576066 CCCACCTTAATGTACGCCAAAAT No data
Right 1171797223 20:29576093-29576115 TCCCTGCAACGGGTGGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171797209 Original CRISPR ATTTTGGCGTACATTAAGGT GGG (reversed) Intergenic
No off target data available for this crispr