ID: 1171797213

View in Genome Browser
Species Human (GRCh38)
Location 20:29576060-29576082
Sequence TTCAACCAGCAGAACTATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171797213_1171797229 23 Left 1171797213 20:29576060-29576082 CCAAAATAGTTCTGCTGGTTGAA No data
Right 1171797229 20:29576106-29576128 TGGGGAAGGGGATTAGCCCGGGG No data
1171797213_1171797220 4 Left 1171797213 20:29576060-29576082 CCAAAATAGTTCTGCTGGTTGAA No data
Right 1171797220 20:29576087-29576109 TGGAGTTCCCTGCAACGGGTGGG No data
1171797213_1171797225 11 Left 1171797213 20:29576060-29576082 CCAAAATAGTTCTGCTGGTTGAA No data
Right 1171797225 20:29576094-29576116 CCCTGCAACGGGTGGGGAAGGGG No data
1171797213_1171797227 21 Left 1171797213 20:29576060-29576082 CCAAAATAGTTCTGCTGGTTGAA No data
Right 1171797227 20:29576104-29576126 GGTGGGGAAGGGGATTAGCCCGG No data
1171797213_1171797216 -1 Left 1171797213 20:29576060-29576082 CCAAAATAGTTCTGCTGGTTGAA No data
Right 1171797216 20:29576082-29576104 AGGCCTGGAGTTCCCTGCAACGG No data
1171797213_1171797223 10 Left 1171797213 20:29576060-29576082 CCAAAATAGTTCTGCTGGTTGAA No data
Right 1171797223 20:29576093-29576115 TCCCTGCAACGGGTGGGGAAGGG No data
1171797213_1171797228 22 Left 1171797213 20:29576060-29576082 CCAAAATAGTTCTGCTGGTTGAA No data
Right 1171797228 20:29576105-29576127 GTGGGGAAGGGGATTAGCCCGGG No data
1171797213_1171797221 5 Left 1171797213 20:29576060-29576082 CCAAAATAGTTCTGCTGGTTGAA No data
Right 1171797221 20:29576088-29576110 GGAGTTCCCTGCAACGGGTGGGG No data
1171797213_1171797217 0 Left 1171797213 20:29576060-29576082 CCAAAATAGTTCTGCTGGTTGAA No data
Right 1171797217 20:29576083-29576105 GGCCTGGAGTTCCCTGCAACGGG No data
1171797213_1171797219 3 Left 1171797213 20:29576060-29576082 CCAAAATAGTTCTGCTGGTTGAA No data
Right 1171797219 20:29576086-29576108 CTGGAGTTCCCTGCAACGGGTGG No data
1171797213_1171797222 9 Left 1171797213 20:29576060-29576082 CCAAAATAGTTCTGCTGGTTGAA No data
Right 1171797222 20:29576092-29576114 TTCCCTGCAACGGGTGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171797213 Original CRISPR TTCAACCAGCAGAACTATTT TGG (reversed) Intergenic
No off target data available for this crispr