ID: 1171797217

View in Genome Browser
Species Human (GRCh38)
Location 20:29576083-29576105
Sequence GGCCTGGAGTTCCCTGCAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171797209_1171797217 16 Left 1171797209 20:29576044-29576066 CCCACCTTAATGTACGCCAAAAT No data
Right 1171797217 20:29576083-29576105 GGCCTGGAGTTCCCTGCAACGGG No data
1171797213_1171797217 0 Left 1171797213 20:29576060-29576082 CCAAAATAGTTCTGCTGGTTGAA No data
Right 1171797217 20:29576083-29576105 GGCCTGGAGTTCCCTGCAACGGG No data
1171797210_1171797217 15 Left 1171797210 20:29576045-29576067 CCACCTTAATGTACGCCAAAATA No data
Right 1171797217 20:29576083-29576105 GGCCTGGAGTTCCCTGCAACGGG No data
1171797211_1171797217 12 Left 1171797211 20:29576048-29576070 CCTTAATGTACGCCAAAATAGTT No data
Right 1171797217 20:29576083-29576105 GGCCTGGAGTTCCCTGCAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171797217 Original CRISPR GGCCTGGAGTTCCCTGCAAC GGG Intergenic
No off target data available for this crispr