ID: 1171797233

View in Genome Browser
Species Human (GRCh38)
Location 20:29576122-29576144
Sequence GCCCCAGGCATTATTTCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171797233_1171797236 -4 Left 1171797233 20:29576122-29576144 CCCGGGGAAATAATGCCTGGGGC No data
Right 1171797236 20:29576141-29576163 GGGCAAGTTGAAGCAGAGTTAGG No data
1171797233_1171797238 7 Left 1171797233 20:29576122-29576144 CCCGGGGAAATAATGCCTGGGGC No data
Right 1171797238 20:29576152-29576174 AGCAGAGTTAGGGAAGATCCAGG No data
1171797233_1171797237 -3 Left 1171797233 20:29576122-29576144 CCCGGGGAAATAATGCCTGGGGC No data
Right 1171797237 20:29576142-29576164 GGCAAGTTGAAGCAGAGTTAGGG No data
1171797233_1171797239 21 Left 1171797233 20:29576122-29576144 CCCGGGGAAATAATGCCTGGGGC No data
Right 1171797239 20:29576166-29576188 AGATCCAGGTCCCTCTGCTGAGG No data
1171797233_1171797240 22 Left 1171797233 20:29576122-29576144 CCCGGGGAAATAATGCCTGGGGC No data
Right 1171797240 20:29576167-29576189 GATCCAGGTCCCTCTGCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171797233 Original CRISPR GCCCCAGGCATTATTTCCCC GGG (reversed) Intergenic
No off target data available for this crispr