ID: 1171797355

View in Genome Browser
Species Human (GRCh38)
Location 20:29577003-29577025
Sequence GAACCCAAGTTGGGACAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171797355_1171797367 30 Left 1171797355 20:29577003-29577025 CCTGCCTGTCCCAACTTGGGTTC No data
Right 1171797367 20:29577056-29577078 CTTTCACCTGGGCTTTCTCTGGG No data
1171797355_1171797365 19 Left 1171797355 20:29577003-29577025 CCTGCCTGTCCCAACTTGGGTTC No data
Right 1171797365 20:29577045-29577067 TGGCTCATAGTCTTTCACCTGGG No data
1171797355_1171797366 29 Left 1171797355 20:29577003-29577025 CCTGCCTGTCCCAACTTGGGTTC No data
Right 1171797366 20:29577055-29577077 TCTTTCACCTGGGCTTTCTCTGG No data
1171797355_1171797364 18 Left 1171797355 20:29577003-29577025 CCTGCCTGTCCCAACTTGGGTTC No data
Right 1171797364 20:29577044-29577066 CTGGCTCATAGTCTTTCACCTGG No data
1171797355_1171797359 -1 Left 1171797355 20:29577003-29577025 CCTGCCTGTCCCAACTTGGGTTC No data
Right 1171797359 20:29577025-29577047 CTATCCTGATCCCTTCCGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171797355 Original CRISPR GAACCCAAGTTGGGACAGGC AGG (reversed) Intergenic
No off target data available for this crispr