ID: 1171798439

View in Genome Browser
Species Human (GRCh38)
Location 20:29584353-29584375
Sequence ACATCTGCCTCTGGGGTCTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171798439_1171798444 -6 Left 1171798439 20:29584353-29584375 CCGAAGACCCCAGAGGCAGATGT No data
Right 1171798444 20:29584370-29584392 AGATGTCAGCAGAAAATGGCAGG No data
1171798439_1171798449 27 Left 1171798439 20:29584353-29584375 CCGAAGACCCCAGAGGCAGATGT No data
Right 1171798449 20:29584403-29584425 TCACTGCCTCTCTTCATCCTGGG No data
1171798439_1171798443 -10 Left 1171798439 20:29584353-29584375 CCGAAGACCCCAGAGGCAGATGT No data
Right 1171798443 20:29584366-29584388 AGGCAGATGTCAGCAGAAAATGG No data
1171798439_1171798445 -5 Left 1171798439 20:29584353-29584375 CCGAAGACCCCAGAGGCAGATGT No data
Right 1171798445 20:29584371-29584393 GATGTCAGCAGAAAATGGCAGGG No data
1171798439_1171798448 26 Left 1171798439 20:29584353-29584375 CCGAAGACCCCAGAGGCAGATGT No data
Right 1171798448 20:29584402-29584424 CTCACTGCCTCTCTTCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171798439 Original CRISPR ACATCTGCCTCTGGGGTCTT CGG (reversed) Intergenic
No off target data available for this crispr