ID: 1171798444

View in Genome Browser
Species Human (GRCh38)
Location 20:29584370-29584392
Sequence AGATGTCAGCAGAAAATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171798437_1171798444 12 Left 1171798437 20:29584335-29584357 CCAGGTGATGAAATCATACCGAA No data
Right 1171798444 20:29584370-29584392 AGATGTCAGCAGAAAATGGCAGG No data
1171798439_1171798444 -6 Left 1171798439 20:29584353-29584375 CCGAAGACCCCAGAGGCAGATGT No data
Right 1171798444 20:29584370-29584392 AGATGTCAGCAGAAAATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171798444 Original CRISPR AGATGTCAGCAGAAAATGGC AGG Intergenic
No off target data available for this crispr