ID: 1171798444 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:29584370-29584392 |
Sequence | AGATGTCAGCAGAAAATGGC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1171798437_1171798444 | 12 | Left | 1171798437 | 20:29584335-29584357 | CCAGGTGATGAAATCATACCGAA | No data | ||
Right | 1171798444 | 20:29584370-29584392 | AGATGTCAGCAGAAAATGGCAGG | No data | ||||
1171798439_1171798444 | -6 | Left | 1171798439 | 20:29584353-29584375 | CCGAAGACCCCAGAGGCAGATGT | No data | ||
Right | 1171798444 | 20:29584370-29584392 | AGATGTCAGCAGAAAATGGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1171798444 | Original CRISPR | AGATGTCAGCAGAAAATGGC AGG | Intergenic | ||
No off target data available for this crispr |