ID: 1171803318

View in Genome Browser
Species Human (GRCh38)
Location 20:29648603-29648625
Sequence GGCCCAGCTGTGTCTCAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171803318_1171803319 -8 Left 1171803318 20:29648603-29648625 CCTGCTTGAGACACAGCTGGGCC No data
Right 1171803319 20:29648618-29648640 GCTGGGCCTTGAGCTTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171803318 Original CRISPR GGCCCAGCTGTGTCTCAAGC AGG (reversed) Intergenic
No off target data available for this crispr