ID: 1171804936

View in Genome Browser
Species Human (GRCh38)
Location 20:29668581-29668603
Sequence CTGGAGACATAAATAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171804936_1171804939 5 Left 1171804936 20:29668581-29668603 CCTTCCTCTATTTATGTCTCCAG No data
Right 1171804939 20:29668609-29668631 TTCAACTCGTTCTTCAAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171804936 Original CRISPR CTGGAGACATAAATAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr