ID: 1171805376

View in Genome Browser
Species Human (GRCh38)
Location 20:29674168-29674190
Sequence CAGTAAAAGTATTTTGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171805373_1171805376 8 Left 1171805373 20:29674137-29674159 CCTCCTCAGTAAATAAGACATGG No data
Right 1171805376 20:29674168-29674190 CAGTAAAAGTATTTTGAGTCTGG No data
1171805375_1171805376 5 Left 1171805375 20:29674140-29674162 CCTCAGTAAATAAGACATGGAAT No data
Right 1171805376 20:29674168-29674190 CAGTAAAAGTATTTTGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171805376 Original CRISPR CAGTAAAAGTATTTTGAGTC TGG Intergenic
No off target data available for this crispr