ID: 1171810638

View in Genome Browser
Species Human (GRCh38)
Location 20:29742744-29742766
Sequence GCGCGGGGCCGCCTTGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171810638_1171810646 -1 Left 1171810638 20:29742744-29742766 CCAGCACCAAGGCGGCCCCGCGC No data
Right 1171810646 20:29742766-29742788 CGGCACCTGGAGCGGCCGACTGG No data
1171810638_1171810650 10 Left 1171810638 20:29742744-29742766 CCAGCACCAAGGCGGCCCCGCGC No data
Right 1171810650 20:29742777-29742799 GCGGCCGACTGGCCTTTGGCGGG No data
1171810638_1171810649 9 Left 1171810638 20:29742744-29742766 CCAGCACCAAGGCGGCCCCGCGC No data
Right 1171810649 20:29742776-29742798 AGCGGCCGACTGGCCTTTGGCGG No data
1171810638_1171810648 6 Left 1171810638 20:29742744-29742766 CCAGCACCAAGGCGGCCCCGCGC No data
Right 1171810648 20:29742773-29742795 TGGAGCGGCCGACTGGCCTTTGG No data
1171810638_1171810652 17 Left 1171810638 20:29742744-29742766 CCAGCACCAAGGCGGCCCCGCGC No data
Right 1171810652 20:29742784-29742806 ACTGGCCTTTGGCGGGCCCGCGG No data
1171810638_1171810642 -9 Left 1171810638 20:29742744-29742766 CCAGCACCAAGGCGGCCCCGCGC No data
Right 1171810642 20:29742758-29742780 GCCCCGCGCGGCACCTGGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171810638 Original CRISPR GCGCGGGGCCGCCTTGGTGC TGG (reversed) Intergenic
No off target data available for this crispr