ID: 1171810866

View in Genome Browser
Species Human (GRCh38)
Location 20:29743548-29743570
Sequence GCGCGAGCGGTGGTTGTGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171810866_1171810869 -5 Left 1171810866 20:29743548-29743570 CCGGGCACAACCACCGCTCGCGC No data
Right 1171810869 20:29743566-29743588 CGCGCAGCCTCCCAACCGCTAGG No data
1171810866_1171810876 12 Left 1171810866 20:29743548-29743570 CCGGGCACAACCACCGCTCGCGC No data
Right 1171810876 20:29743583-29743605 GCTAGGACGCCGGCTCGGCCCGG No data
1171810866_1171810871 2 Left 1171810866 20:29743548-29743570 CCGGGCACAACCACCGCTCGCGC No data
Right 1171810871 20:29743573-29743595 CCTCCCAACCGCTAGGACGCCGG No data
1171810866_1171810878 16 Left 1171810866 20:29743548-29743570 CCGGGCACAACCACCGCTCGCGC No data
Right 1171810878 20:29743587-29743609 GGACGCCGGCTCGGCCCGGCGGG No data
1171810866_1171810877 15 Left 1171810866 20:29743548-29743570 CCGGGCACAACCACCGCTCGCGC No data
Right 1171810877 20:29743586-29743608 AGGACGCCGGCTCGGCCCGGCGG No data
1171810866_1171810874 7 Left 1171810866 20:29743548-29743570 CCGGGCACAACCACCGCTCGCGC No data
Right 1171810874 20:29743578-29743600 CAACCGCTAGGACGCCGGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171810866 Original CRISPR GCGCGAGCGGTGGTTGTGCC CGG (reversed) Intergenic