ID: 1171811490

View in Genome Browser
Species Human (GRCh38)
Location 20:29747113-29747135
Sequence CTTTTTTGAAGGGGCTCCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171811490_1171811495 -6 Left 1171811490 20:29747113-29747135 CCACCGGAGCCCCTTCAAAAAAG No data
Right 1171811495 20:29747130-29747152 AAAAAGTCTGTTGCCAGAATTGG No data
1171811490_1171811499 30 Left 1171811490 20:29747113-29747135 CCACCGGAGCCCCTTCAAAAAAG No data
Right 1171811499 20:29747166-29747188 AAGTCTGTCTTCTCACAGAGTGG No data
1171811490_1171811496 3 Left 1171811490 20:29747113-29747135 CCACCGGAGCCCCTTCAAAAAAG No data
Right 1171811496 20:29747139-29747161 GTTGCCAGAATTGGCCAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171811490 Original CRISPR CTTTTTTGAAGGGGCTCCGG TGG (reversed) Intergenic
No off target data available for this crispr