ID: 1171811846

View in Genome Browser
Species Human (GRCh38)
Location 20:29750725-29750747
Sequence GATACCTCTGCATTGGCCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171811846_1171811852 -1 Left 1171811846 20:29750725-29750747 CCTCGGGCCAATGCAGAGGTATC No data
Right 1171811852 20:29750747-29750769 CCATTTGACCTCGGTGGGACAGG No data
1171811846_1171811849 -7 Left 1171811846 20:29750725-29750747 CCTCGGGCCAATGCAGAGGTATC No data
Right 1171811849 20:29750741-29750763 AGGTATCCATTTGACCTCGGTGG No data
1171811846_1171811853 6 Left 1171811846 20:29750725-29750747 CCTCGGGCCAATGCAGAGGTATC No data
Right 1171811853 20:29750754-29750776 ACCTCGGTGGGACAGGTCAGCGG No data
1171811846_1171811855 26 Left 1171811846 20:29750725-29750747 CCTCGGGCCAATGCAGAGGTATC No data
Right 1171811855 20:29750774-29750796 CGGAGTCCCGTGCGTCCTTCCGG No data
1171811846_1171811850 -6 Left 1171811846 20:29750725-29750747 CCTCGGGCCAATGCAGAGGTATC No data
Right 1171811850 20:29750742-29750764 GGTATCCATTTGACCTCGGTGGG No data
1171811846_1171811848 -10 Left 1171811846 20:29750725-29750747 CCTCGGGCCAATGCAGAGGTATC No data
Right 1171811848 20:29750738-29750760 CAGAGGTATCCATTTGACCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171811846 Original CRISPR GATACCTCTGCATTGGCCCG AGG (reversed) Intergenic
No off target data available for this crispr