ID: 1171812876

View in Genome Browser
Species Human (GRCh38)
Location 20:29759618-29759640
Sequence GGACCTCTGTTCTTGAAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171812876_1171812884 30 Left 1171812876 20:29759618-29759640 CCCGCTTTCAAGAACAGAGGTCC No data
Right 1171812884 20:29759671-29759693 CGTTTATTGAGACTAGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171812876 Original CRISPR GGACCTCTGTTCTTGAAAGC GGG (reversed) Intergenic
No off target data available for this crispr