ID: 1171814000

View in Genome Browser
Species Human (GRCh38)
Location 20:29767287-29767309
Sequence CTGTAGAAGCTGAATGGATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171814000_1171814002 12 Left 1171814000 20:29767287-29767309 CCTTATCCATTCAGCTTCTACAG No data
Right 1171814002 20:29767322-29767344 TTAAAAAAAAATACCCTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171814000 Original CRISPR CTGTAGAAGCTGAATGGATA AGG (reversed) Intergenic
No off target data available for this crispr