ID: 1171816187

View in Genome Browser
Species Human (GRCh38)
Location 20:29787783-29787805
Sequence CTGTGGGACTCGCATTCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171816187_1171816196 9 Left 1171816187 20:29787783-29787805 CCTCCAGAATGCGAGTCCCACAG No data
Right 1171816196 20:29787815-29787837 GAAGGAATGGCAGCTCTGTGTGG No data
1171816187_1171816192 -9 Left 1171816187 20:29787783-29787805 CCTCCAGAATGCGAGTCCCACAG No data
Right 1171816192 20:29787797-29787819 GTCCCACAGGGTCTGGCAGAAGG No data
1171816187_1171816197 26 Left 1171816187 20:29787783-29787805 CCTCCAGAATGCGAGTCCCACAG No data
Right 1171816197 20:29787832-29787854 GTGTGGACCCTCTAGAATACAGG No data
1171816187_1171816195 -4 Left 1171816187 20:29787783-29787805 CCTCCAGAATGCGAGTCCCACAG No data
Right 1171816195 20:29787802-29787824 ACAGGGTCTGGCAGAAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171816187 Original CRISPR CTGTGGGACTCGCATTCTGG AGG (reversed) Intergenic
No off target data available for this crispr