ID: 1171816201

View in Genome Browser
Species Human (GRCh38)
Location 20:29787856-29787878
Sequence CACTGTGTGCAGGTTGCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171816199_1171816201 -7 Left 1171816199 20:29787840-29787862 CCTCTAGAATACAGGTCACTGTG No data
Right 1171816201 20:29787856-29787878 CACTGTGTGCAGGTTGCACAAGG No data
1171816198_1171816201 -6 Left 1171816198 20:29787839-29787861 CCCTCTAGAATACAGGTCACTGT No data
Right 1171816201 20:29787856-29787878 CACTGTGTGCAGGTTGCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171816201 Original CRISPR CACTGTGTGCAGGTTGCACA AGG Intergenic
No off target data available for this crispr