ID: 1171818772

View in Genome Browser
Species Human (GRCh38)
Location 20:29813166-29813188
Sequence GAGGAACTCAAGCAGGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171818772_1171818776 16 Left 1171818772 20:29813166-29813188 CCCATATCCTGCTTGAGTTCCTC No data
Right 1171818776 20:29813205-29813227 TATATTTCAGCCACCTGACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171818772 Original CRISPR GAGGAACTCAAGCAGGATAT GGG (reversed) Intergenic
No off target data available for this crispr