ID: 1171823211

View in Genome Browser
Species Human (GRCh38)
Location 20:29874263-29874285
Sequence CTGGGCTTCGGCTGGGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171823211_1171823223 16 Left 1171823211 20:29874263-29874285 CCCGCGCCCCAGCCGAAGCCCAG No data
Right 1171823223 20:29874302-29874324 TCCGCCACTGCAGCACCGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171823211 Original CRISPR CTGGGCTTCGGCTGGGGCGC GGG (reversed) Intergenic
No off target data available for this crispr