ID: 1171824738 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:29884613-29884635 |
Sequence | ATATTTCAGACTATTGCATG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1171824732_1171824738 | -8 | Left | 1171824732 | 20:29884598-29884620 | CCTTCCCATGAGACCATATTTCA | 0: 4 1: 51 2: 430 3: 225 4: 359 |
||
Right | 1171824738 | 20:29884613-29884635 | ATATTTCAGACTATTGCATGGGG | No data | ||||
1171824731_1171824738 | -7 | Left | 1171824731 | 20:29884597-29884619 | CCCTTCCCATGAGACCATATTTC | 0: 3 1: 45 2: 400 3: 265 4: 500 |
||
Right | 1171824738 | 20:29884613-29884635 | ATATTTCAGACTATTGCATGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1171824738 | Original CRISPR | ATATTTCAGACTATTGCATG GGG | Intergenic | ||
No off target data available for this crispr |