ID: 1171824738

View in Genome Browser
Species Human (GRCh38)
Location 20:29884613-29884635
Sequence ATATTTCAGACTATTGCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171824732_1171824738 -8 Left 1171824732 20:29884598-29884620 CCTTCCCATGAGACCATATTTCA 0: 4
1: 51
2: 430
3: 225
4: 359
Right 1171824738 20:29884613-29884635 ATATTTCAGACTATTGCATGGGG No data
1171824731_1171824738 -7 Left 1171824731 20:29884597-29884619 CCCTTCCCATGAGACCATATTTC 0: 3
1: 45
2: 400
3: 265
4: 500
Right 1171824738 20:29884613-29884635 ATATTTCAGACTATTGCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171824738 Original CRISPR ATATTTCAGACTATTGCATG GGG Intergenic
No off target data available for this crispr