ID: 1171838676

View in Genome Browser
Species Human (GRCh38)
Location 20:30182263-30182285
Sequence CAGTAAAAGTACTTTGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171838676_1171838678 7 Left 1171838676 20:30182263-30182285 CCAGACTCAAAGTACTTTTACTG No data
Right 1171838678 20:30182293-30182315 TGCTTGTCTTATTACTGAGGAGG No data
1171838676_1171838677 4 Left 1171838676 20:30182263-30182285 CCAGACTCAAAGTACTTTTACTG No data
Right 1171838677 20:30182290-30182312 GATTGCTTGTCTTATTACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171838676 Original CRISPR CAGTAAAAGTACTTTGAGTC TGG (reversed) Intergenic
No off target data available for this crispr