ID: 1171839123

View in Genome Browser
Species Human (GRCh38)
Location 20:30187847-30187869
Sequence CTGGAGACATAAATAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171839120_1171839123 5 Left 1171839120 20:30187819-30187841 CCAGATTTGAAGAACGAGTTGAA No data
Right 1171839123 20:30187847-30187869 CTGGAGACATAAATAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171839123 Original CRISPR CTGGAGACATAAATAGAGGA AGG Intergenic
No off target data available for this crispr