ID: 1171843348

View in Genome Browser
Species Human (GRCh38)
Location 20:30242246-30242268
Sequence CTGTTTATGGAGATGTAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171843348_1171843351 0 Left 1171843348 20:30242246-30242268 CCTAGCTACATCTCCATAAACAG No data
Right 1171843351 20:30242269-30242291 ACTCTTTAGGTTCTTGACAGTGG No data
1171843348_1171843352 13 Left 1171843348 20:30242246-30242268 CCTAGCTACATCTCCATAAACAG No data
Right 1171843352 20:30242282-30242304 TTGACAGTGGAAACTCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171843348 Original CRISPR CTGTTTATGGAGATGTAGCT AGG (reversed) Intergenic
No off target data available for this crispr