ID: 1171845651

View in Genome Browser
Species Human (GRCh38)
Location 20:30272803-30272825
Sequence AGATGTCAGCAGAAAATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171845651_1171845656 -6 Left 1171845651 20:30272803-30272825 CCTGCCATTTTCTGCTGACATCT No data
Right 1171845656 20:30272820-30272842 ACATCTGCCTCTGGGGTTTTTGG No data
1171845651_1171845658 12 Left 1171845651 20:30272803-30272825 CCTGCCATTTTCTGCTGACATCT No data
Right 1171845658 20:30272838-30272860 TTTGGTATGATTTCATCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171845651 Original CRISPR AGATGTCAGCAGAAAATGGC AGG (reversed) Intergenic
No off target data available for this crispr