ID: 1171845656

View in Genome Browser
Species Human (GRCh38)
Location 20:30272820-30272842
Sequence ACATCTGCCTCTGGGGTTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171845652_1171845656 -10 Left 1171845652 20:30272807-30272829 CCATTTTCTGCTGACATCTGCCT No data
Right 1171845656 20:30272820-30272842 ACATCTGCCTCTGGGGTTTTTGG No data
1171845651_1171845656 -6 Left 1171845651 20:30272803-30272825 CCTGCCATTTTCTGCTGACATCT No data
Right 1171845656 20:30272820-30272842 ACATCTGCCTCTGGGGTTTTTGG No data
1171845650_1171845656 -5 Left 1171845650 20:30272802-30272824 CCCTGCCATTTTCTGCTGACATC No data
Right 1171845656 20:30272820-30272842 ACATCTGCCTCTGGGGTTTTTGG No data
1171845647_1171845656 26 Left 1171845647 20:30272771-30272793 CCAGGATGAAGGGAGGCAGTGAG 0: 20
1: 55
2: 48
3: 164
4: 620
Right 1171845656 20:30272820-30272842 ACATCTGCCTCTGGGGTTTTTGG No data
1171845646_1171845656 27 Left 1171845646 20:30272770-30272792 CCCAGGATGAAGGGAGGCAGTGA 0: 28
1: 52
2: 47
3: 116
4: 464
Right 1171845656 20:30272820-30272842 ACATCTGCCTCTGGGGTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171845656 Original CRISPR ACATCTGCCTCTGGGGTTTT TGG Intergenic
No off target data available for this crispr