ID: 1171845658

View in Genome Browser
Species Human (GRCh38)
Location 20:30272838-30272860
Sequence TTTGGTATGATTTCATCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171845652_1171845658 8 Left 1171845652 20:30272807-30272829 CCATTTTCTGCTGACATCTGCCT No data
Right 1171845658 20:30272838-30272860 TTTGGTATGATTTCATCACCTGG No data
1171845650_1171845658 13 Left 1171845650 20:30272802-30272824 CCCTGCCATTTTCTGCTGACATC No data
Right 1171845658 20:30272838-30272860 TTTGGTATGATTTCATCACCTGG No data
1171845651_1171845658 12 Left 1171845651 20:30272803-30272825 CCTGCCATTTTCTGCTGACATCT No data
Right 1171845658 20:30272838-30272860 TTTGGTATGATTTCATCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171845658 Original CRISPR TTTGGTATGATTTCATCACC TGG Intergenic
No off target data available for this crispr