ID: 1171845986

View in Genome Browser
Species Human (GRCh38)
Location 20:30275068-30275090
Sequence GGAGGAGTTTGAAGACTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171845986_1171845998 28 Left 1171845986 20:30275068-30275090 CCTCACAGTCTTCAAACTCCTCC No data
Right 1171845998 20:30275119-30275141 GGCTCATGAAGGCCCTATGTTGG No data
1171845986_1171845991 1 Left 1171845986 20:30275068-30275090 CCTCACAGTCTTCAAACTCCTCC No data
Right 1171845991 20:30275092-30275114 TCTCCTGTGGGACCCTACCACGG No data
1171845986_1171845993 7 Left 1171845986 20:30275068-30275090 CCTCACAGTCTTCAAACTCCTCC No data
Right 1171845993 20:30275098-30275120 GTGGGACCCTACCACGGAGATGG No data
1171845986_1171845996 17 Left 1171845986 20:30275068-30275090 CCTCACAGTCTTCAAACTCCTCC No data
Right 1171845996 20:30275108-30275130 ACCACGGAGATGGCTCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171845986 Original CRISPR GGAGGAGTTTGAAGACTGTG AGG (reversed) Intergenic
No off target data available for this crispr