ID: 1171845990

View in Genome Browser
Species Human (GRCh38)
Location 20:30275089-30275111
Sequence TGGTAGGGTCCCACAGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171845990_1171845998 7 Left 1171845990 20:30275089-30275111 CCTTCTCCTGTGGGACCCTACCA No data
Right 1171845998 20:30275119-30275141 GGCTCATGAAGGCCCTATGTTGG No data
1171845990_1171845996 -4 Left 1171845990 20:30275089-30275111 CCTTCTCCTGTGGGACCCTACCA No data
Right 1171845996 20:30275108-30275130 ACCACGGAGATGGCTCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171845990 Original CRISPR TGGTAGGGTCCCACAGGAGA AGG (reversed) Intergenic
No off target data available for this crispr