ID: 1171845995

View in Genome Browser
Species Human (GRCh38)
Location 20:30275105-30275127
Sequence TCATGAGCCATCTCCGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171845995_1171846001 15 Left 1171845995 20:30275105-30275127 CCTACCACGGAGATGGCTCATGA No data
Right 1171846001 20:30275143-30275165 GACTATTAGCATGCAGCAGTTGG No data
1171845995_1171846002 25 Left 1171845995 20:30275105-30275127 CCTACCACGGAGATGGCTCATGA No data
Right 1171846002 20:30275153-30275175 ATGCAGCAGTTGGTTGCTGCAGG No data
1171845995_1171845998 -9 Left 1171845995 20:30275105-30275127 CCTACCACGGAGATGGCTCATGA No data
Right 1171845998 20:30275119-30275141 GGCTCATGAAGGCCCTATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171845995 Original CRISPR TCATGAGCCATCTCCGTGGT AGG (reversed) Intergenic
No off target data available for this crispr