ID: 1171845998

View in Genome Browser
Species Human (GRCh38)
Location 20:30275119-30275141
Sequence GGCTCATGAAGGCCCTATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171845989_1171845998 10 Left 1171845989 20:30275086-30275108 CCTCCTTCTCCTGTGGGACCCTA No data
Right 1171845998 20:30275119-30275141 GGCTCATGAAGGCCCTATGTTGG No data
1171845995_1171845998 -9 Left 1171845995 20:30275105-30275127 CCTACCACGGAGATGGCTCATGA No data
Right 1171845998 20:30275119-30275141 GGCTCATGAAGGCCCTATGTTGG No data
1171845990_1171845998 7 Left 1171845990 20:30275089-30275111 CCTTCTCCTGTGGGACCCTACCA No data
Right 1171845998 20:30275119-30275141 GGCTCATGAAGGCCCTATGTTGG No data
1171845992_1171845998 1 Left 1171845992 20:30275095-30275117 CCTGTGGGACCCTACCACGGAGA No data
Right 1171845998 20:30275119-30275141 GGCTCATGAAGGCCCTATGTTGG No data
1171845994_1171845998 -8 Left 1171845994 20:30275104-30275126 CCCTACCACGGAGATGGCTCATG No data
Right 1171845998 20:30275119-30275141 GGCTCATGAAGGCCCTATGTTGG No data
1171845986_1171845998 28 Left 1171845986 20:30275068-30275090 CCTCACAGTCTTCAAACTCCTCC No data
Right 1171845998 20:30275119-30275141 GGCTCATGAAGGCCCTATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171845998 Original CRISPR GGCTCATGAAGGCCCTATGT TGG Intergenic
No off target data available for this crispr