ID: 1171846001

View in Genome Browser
Species Human (GRCh38)
Location 20:30275143-30275165
Sequence GACTATTAGCATGCAGCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171845992_1171846001 25 Left 1171845992 20:30275095-30275117 CCTGTGGGACCCTACCACGGAGA No data
Right 1171846001 20:30275143-30275165 GACTATTAGCATGCAGCAGTTGG No data
1171845995_1171846001 15 Left 1171845995 20:30275105-30275127 CCTACCACGGAGATGGCTCATGA No data
Right 1171846001 20:30275143-30275165 GACTATTAGCATGCAGCAGTTGG No data
1171845994_1171846001 16 Left 1171845994 20:30275104-30275126 CCCTACCACGGAGATGGCTCATG No data
Right 1171846001 20:30275143-30275165 GACTATTAGCATGCAGCAGTTGG No data
1171845997_1171846001 11 Left 1171845997 20:30275109-30275131 CCACGGAGATGGCTCATGAAGGC No data
Right 1171846001 20:30275143-30275165 GACTATTAGCATGCAGCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171846001 Original CRISPR GACTATTAGCATGCAGCAGT TGG Intergenic
No off target data available for this crispr