ID: 1171846002

View in Genome Browser
Species Human (GRCh38)
Location 20:30275153-30275175
Sequence ATGCAGCAGTTGGTTGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171846000_1171846002 -2 Left 1171846000 20:30275132-30275154 CCTATGTTGGAGACTATTAGCAT No data
Right 1171846002 20:30275153-30275175 ATGCAGCAGTTGGTTGCTGCAGG No data
1171845994_1171846002 26 Left 1171845994 20:30275104-30275126 CCCTACCACGGAGATGGCTCATG No data
Right 1171846002 20:30275153-30275175 ATGCAGCAGTTGGTTGCTGCAGG No data
1171845995_1171846002 25 Left 1171845995 20:30275105-30275127 CCTACCACGGAGATGGCTCATGA No data
Right 1171846002 20:30275153-30275175 ATGCAGCAGTTGGTTGCTGCAGG No data
1171845999_1171846002 -1 Left 1171845999 20:30275131-30275153 CCCTATGTTGGAGACTATTAGCA No data
Right 1171846002 20:30275153-30275175 ATGCAGCAGTTGGTTGCTGCAGG No data
1171845997_1171846002 21 Left 1171845997 20:30275109-30275131 CCACGGAGATGGCTCATGAAGGC No data
Right 1171846002 20:30275153-30275175 ATGCAGCAGTTGGTTGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171846002 Original CRISPR ATGCAGCAGTTGGTTGCTGC AGG Intergenic
No off target data available for this crispr