ID: 1171847599

View in Genome Browser
Species Human (GRCh38)
Location 20:30286474-30286496
Sequence TCTCCTAGCTGGTTTCCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171847596_1171847599 -5 Left 1171847596 20:30286456-30286478 CCTCCGTAAGTACACAACTCTCC 0: 1
1: 5
2: 2
3: 1
4: 34
Right 1171847599 20:30286474-30286496 TCTCCTAGCTGGTTTCCTAGAGG No data
1171847593_1171847599 12 Left 1171847593 20:30286439-30286461 CCTTTTGTAACTCCATCCCTCCG 0: 1
1: 7
2: 0
3: 6
4: 165
Right 1171847599 20:30286474-30286496 TCTCCTAGCTGGTTTCCTAGAGG No data
1171847595_1171847599 -4 Left 1171847595 20:30286455-30286477 CCCTCCGTAAGTACACAACTCTC 0: 1
1: 5
2: 2
3: 5
4: 63
Right 1171847599 20:30286474-30286496 TCTCCTAGCTGGTTTCCTAGAGG No data
1171847597_1171847599 -8 Left 1171847597 20:30286459-30286481 CCGTAAGTACACAACTCTCCTAG No data
Right 1171847599 20:30286474-30286496 TCTCCTAGCTGGTTTCCTAGAGG No data
1171847594_1171847599 0 Left 1171847594 20:30286451-30286473 CCATCCCTCCGTAAGTACACAAC 0: 1
1: 7
2: 0
3: 2
4: 65
Right 1171847599 20:30286474-30286496 TCTCCTAGCTGGTTTCCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171847599 Original CRISPR TCTCCTAGCTGGTTTCCTAG AGG Intergenic
No off target data available for this crispr