ID: 1171848494

View in Genome Browser
Species Human (GRCh38)
Location 20:30291888-30291910
Sequence TCTCAGATGGGGCAGCTGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6805
Summary {0: 20, 1: 340, 2: 723, 3: 1614, 4: 4108}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171848479_1171848494 24 Left 1171848479 20:30291841-30291863 CCTCACGTCCCAGACAGGGCGGC No data
Right 1171848494 20:30291888-30291910 TCTCAGATGGGGCAGCTGCCGGG 0: 20
1: 340
2: 723
3: 1614
4: 4108
1171848482_1171848494 16 Left 1171848482 20:30291849-30291871 CCCAGACAGGGCGGCTGCCGGGC 0: 21
1: 269
2: 1112
3: 3427
4: 4784
Right 1171848494 20:30291888-30291910 TCTCAGATGGGGCAGCTGCCGGG 0: 20
1: 340
2: 723
3: 1614
4: 4108
1171848488_1171848494 -1 Left 1171848488 20:30291866-30291888 CCGGGCGGAGGGGCTCCTCACTT 0: 1291
1: 4807
2: 5115
3: 7429
4: 7139
Right 1171848494 20:30291888-30291910 TCTCAGATGGGGCAGCTGCCGGG 0: 20
1: 340
2: 723
3: 1614
4: 4108
1171848483_1171848494 15 Left 1171848483 20:30291850-30291872 CCAGACAGGGCGGCTGCCGGGCG 0: 28
1: 404
2: 1296
3: 1528
4: 2761
Right 1171848494 20:30291888-30291910 TCTCAGATGGGGCAGCTGCCGGG 0: 20
1: 340
2: 723
3: 1614
4: 4108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171848494 Original CRISPR TCTCAGATGGGGCAGCTGCC GGG Intergenic
Too many off-targets to display for this crispr