ID: 1171849305

View in Genome Browser
Species Human (GRCh38)
Location 20:30296713-30296735
Sequence TCCCTCTCTGGTGCTGGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171849305_1171849312 26 Left 1171849305 20:30296713-30296735 CCTCATCCAGCACCAGAGAGGGA No data
Right 1171849312 20:30296762-30296784 ATAAGCAGGGCCCATTTACCAGG No data
1171849305_1171849310 12 Left 1171849305 20:30296713-30296735 CCTCATCCAGCACCAGAGAGGGA No data
Right 1171849310 20:30296748-30296770 ACACAGTCTTGCAGATAAGCAGG No data
1171849305_1171849311 13 Left 1171849305 20:30296713-30296735 CCTCATCCAGCACCAGAGAGGGA No data
Right 1171849311 20:30296749-30296771 CACAGTCTTGCAGATAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171849305 Original CRISPR TCCCTCTCTGGTGCTGGATG AGG (reversed) Intergenic
No off target data available for this crispr