ID: 1171849311

View in Genome Browser
Species Human (GRCh38)
Location 20:30296749-30296771
Sequence CACAGTCTTGCAGATAAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171849308_1171849311 7 Left 1171849308 20:30296719-30296741 CCAGCACCAGAGAGGGAGGGATA No data
Right 1171849311 20:30296749-30296771 CACAGTCTTGCAGATAAGCAGGG No data
1171849305_1171849311 13 Left 1171849305 20:30296713-30296735 CCTCATCCAGCACCAGAGAGGGA No data
Right 1171849311 20:30296749-30296771 CACAGTCTTGCAGATAAGCAGGG No data
1171849309_1171849311 1 Left 1171849309 20:30296725-30296747 CCAGAGAGGGAGGGATAAAAATT No data
Right 1171849311 20:30296749-30296771 CACAGTCTTGCAGATAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171849311 Original CRISPR CACAGTCTTGCAGATAAGCA GGG Intergenic
No off target data available for this crispr